View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18603_high_16 (Length: 243)
Name: NF18603_high_16
Description: NF18603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18603_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 21 - 224
Target Start/End: Complemental strand, 39168552 - 39168351
Alignment:
| Q |
21 |
gcagaaaattgggacgatttcaacnnnnnnntggtatttaatctcagaaggaatggaatgacaacgagtcttgataggaactgtgcgccttatacaatcc |
120 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39168552 |
gcagaaaattgggacgatttcaacaaaaaaatggtatttaatctcagaaggaatggaatcacaacgagtcttgataggaactgtgcgccttatacaatcc |
39168453 |
T |
 |
| Q |
121 |
acaagatgtccagcacgagctacact-cactattgaaatagaaagaaaaaccttgatcgttgtgaatgattctcctaacaacaccaacaaggcaactata |
219 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
39168452 |
acaagatgtccagcacgagctacactacactactgaaatagaaagaaaaaccttgatcgttgtgaatgattctcct---aacaccaacaaggcaactata |
39168356 |
T |
 |
| Q |
220 |
aacgt |
224 |
Q |
| |
|
||||| |
|
|
| T |
39168355 |
aacgt |
39168351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University