View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18603_high_7 (Length: 420)
Name: NF18603_high_7
Description: NF18603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18603_high_7 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 412; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 412; E-Value: 0
Query Start/End: Original strand, 1 - 420
Target Start/End: Complemental strand, 2065122 - 2064703
Alignment:
| Q |
1 |
taatactctagaccttctcttcacaaaaacgtcgtcgttatggatactacatttacaccaccgtcaccacaccgttcatctccgttacaaaacataagcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2065122 |
taatactctagaccttctcttcacaaaaacgtcgtcgttatggatactacatttacaccaccgtcaccacaccgttcatctccgttacaaaacataagcc |
2065023 |
T |
|
| Q |
101 |
ctagcattctcatcattataacaatcctcgccgtcaccgtcatcgttactcttctaatctgcttcctcctccgccacctcaactgtcaccgtctccgccg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2065022 |
ctagcattctcatcattataacaatcctcgccgtcaccgtcatcgtttctcttctaatctgcttcctcctccgccacctcaactgtcaccgtctccgccg |
2064923 |
T |
|
| Q |
201 |
taatccatctccaacaaccaccgaacctcctcctcacactcacagccgtcgtatctctccagaaacaacacctccctccgtcatcgactcactccctctc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2064922 |
taatccatctccaacaaccaccgaacctcctcctcacactcacagccgtcgtatctctccagaaacaacacctccctccgtcatcgactcactccctctc |
2064823 |
T |
|
| Q |
301 |
ttcacattctcatccatctcccgtcgttcctccgccgtcaccgccgctgattgcgctgtctgtttatcaaagttccgtaactccgacctcctccgttctc |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2064822 |
ttcacattctcatccatctcccgtcgttcctccgccgtcaccgccgctgactgcgctgtctgtttatcaaagttccgtaactccgacctcctccgttctc |
2064723 |
T |
|
| Q |
401 |
ttcctctctgttgccacgct |
420 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
2064722 |
ttcctctctgttgccacgct |
2064703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University