View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18603_high_9 (Length: 361)
Name: NF18603_high_9
Description: NF18603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18603_high_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 1 - 352
Target Start/End: Original strand, 10306768 - 10307119
Alignment:
| Q |
1 |
catttctcctccatttccaccaccgctaccgccaccgccaactgtgcagtttgccttaccgcgttcagcaccactgacctcctccgcgctctccctaggt |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10306768 |
catttctcctccatttccacgaccgctaccgccactgccgactgtgcagtttgccttaccgcgttcagcaccactgacctcctccgcgctctccctaggt |
10306867 |
T |
|
| Q |
101 |
gttgtcacgcctttcactccgactgtattgacaattggctccgttcttccaacctctcatgttgtccgctttgccgttccaccattttcgcttcagaatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10306868 |
gttgtcacgcctttcactccgactgtattgacaattggctccgttcttccaacctctcatgttgtccgctttgccgttccacaattttcgcttcagaatc |
10306967 |
T |
|
| Q |
201 |
cgacctcgcggcgattctccgatcaccttccgacagtttccgagttgaaattggaaatgtgacttatccagaagctgtcggcggagacgcattgtcatca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10306968 |
cgacctcgcggcgattctccgatcaccttccgacagtttccgagttgaaattggaaatgtgacttatccagaagctgtcggcggagacgcattgtcatca |
10307067 |
T |
|
| Q |
301 |
tatttcattggaggatcattcgattatcgtgtaatggaggtatcacaggttc |
352 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
10307068 |
tattccattggaggatcattcgattatcgtgtaatggaggtatcgcaggttc |
10307119 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 90; Significance: 2e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 149 - 262
Target Start/End: Original strand, 1722082 - 1722195
Alignment:
| Q |
149 |
ccaacctctcatgttgtccgctttgccgttccaccattttcgcttcagaatccgacctcgcggcgattctccgatcaccttccgacagtttccgagttga |
248 |
Q |
| |
|
|||||||||||||||||| ||| |||| ||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
1722082 |
ccaacctctcatgttgtcggctctgccattccaccattttcgcttcagaattcgacctcgccgcgattctccgatcaccttccgacagtttccgagatga |
1722181 |
T |
|
| Q |
249 |
aattggaaatgtga |
262 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
1722182 |
aattggaaatgtga |
1722195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University