View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18603_low_20 (Length: 251)
Name: NF18603_low_20
Description: NF18603
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18603_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 10 - 243
Target Start/End: Complemental strand, 10676233 - 10676001
Alignment:
| Q |
10 |
tatatatgggttcgctatatatatgaaattaagtctcaagaagttggcttgtggaaacatgcatgtgcattgtgcaatagtaaaggaaggaatggtgtta |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10676233 |
tatatatgggttcgctatatatatgaaattaagtctcaagaagttggcttgtggaaacatgcatgtgcattgtgcaatagtaaaggaagtaatggtgtta |
10676134 |
T |
|
| Q |
110 |
tgattttacgggttgtcttttttattagtattttttatgtatgttgataagtaattctctaagatgtacttcaagaaaatctgtgtttagctactacaat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10676133 |
tgattttacgggttgtcttttttattagtat-ttttatgtatgttgataagtaattctctaagatgtacttcaagaaaatctgtgtttagctactacaat |
10676035 |
T |
|
| Q |
210 |
agataaaagttaatttcaagttcaagttcatctc |
243 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| |
|
|
| T |
10676034 |
aaataaaagttaatttcaagttcaagttcatctc |
10676001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University