View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18604_low_10 (Length: 340)
Name: NF18604_low_10
Description: NF18604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18604_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 299; Significance: 1e-168; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 1 - 331
Target Start/End: Complemental strand, 22278450 - 22278120
Alignment:
| Q |
1 |
gctatttacttcttcaaagcctcttcaggtatcatttccgctatcaattctattttatgttgtcttttttggggtgggggtgaggaatataggtaaactt |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
22278450 |
gctatctacttcttcaaagcctcttcaggtatcatttcctctatcgattctattttatgttgtcttttttggggtgggggtgaggaatataggtaaattt |
22278351 |
T |
|
| Q |
101 |
tctgggtttattcagattatgtttgtttgagtaaggaggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatg |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22278350 |
tctaggtttattcagattatgtttgtttgagtaaggaggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatg |
22278251 |
T |
|
| Q |
201 |
ttggtggatcagggtgattgttgtattgtacgtctgtggcgaggtacgaagtataaagtgggtgggtgaaggaggggagtctgggagggtcgagttggtg |
300 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22278250 |
ttggtggatcagggggattgttgtattgtacgtctgtggcgaggtacgaagtataaagtgggtgggtgaaggaggggggtctgggagggtcgagttggtg |
22278151 |
T |
|
| Q |
301 |
gaaagatatcgtgaggattcgtgatgatgtc |
331 |
Q |
| |
|
||| ||||||||||||||||||||||||||| |
|
|
| T |
22278150 |
gaaggatatcgtgaggattcgtgatgatgtc |
22278120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 133 - 209
Target Start/End: Complemental strand, 7287375 - 7287299
Alignment:
| Q |
133 |
aaggaggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtggat |
209 |
Q |
| |
|
||||||||||||||| |||||||| || ||||| |||| |||||| || || | || |||||||| |||||| |||| |
|
|
| T |
7287375 |
aaggaggaaggaggtttgggggtgcggcggttatgtgaatttaatatttcattattaggaaaatggtgttggcggat |
7287299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 133 - 209
Target Start/End: Complemental strand, 7288043 - 7287967
Alignment:
| Q |
133 |
aaggaggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtggat |
209 |
Q |
| |
|
||||||||||||||| |||||||| || ||||| |||| |||||| || || | || |||||||| |||||| |||| |
|
|
| T |
7288043 |
aaggaggaaggaggtttgggggtgcggcggttatgtgaatttaatatttcattattaggaaaatggtgttggcggat |
7287967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 9 - 78
Target Start/End: Original strand, 41352565 - 41352634
Alignment:
| Q |
9 |
cttcttcaaagcctcttcaggtatcatttccgctatcaattctattttatgttgtcttttttggggtggg |
78 |
Q |
| |
|
||||||||||||| | |||| |||||||||| |||| |||||||||||||| || | |||| ||||||| |
|
|
| T |
41352565 |
cttcttcaaagccccgtcagatatcatttcctctattgattctattttatgtcgtttcttttagggtggg |
41352634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 137 - 206
Target Start/End: Original strand, 51072127 - 51072196
Alignment:
| Q |
137 |
aggaaggaggtatgggggtgaggtggttaagtgagtttaatgttgcactgttgggaaaatgatgttggtg |
206 |
Q |
| |
|
||||||||||| ||||||| ||| || | || |||||||||||||| ||||| || ||||| |||||||| |
|
|
| T |
51072127 |
aggaaggaggtttgggggtcaggaggatgagggagtttaatgttgctctgttagggaaatggtgttggtg |
51072196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University