View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18604_low_15 (Length: 265)
Name: NF18604_low_15
Description: NF18604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18604_low_15 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 13 - 265
Target Start/End: Complemental strand, 54536517 - 54536264
Alignment:
| Q |
13 |
aaatcgtttggtggcgagttactttggataattacgttcagtcacttgatactttgacaaacatatatagagccaagagagacccctttcaccatatcaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
54536517 |
aaatcgtttggtggcgagttactttggataattacgttcagtcacttgatactttgacaaacatatatagagccaagagagacccttttcaccatatcaa |
54536418 |
T |
 |
| Q |
113 |
aatggatgagtacgtttcaacttccacgggatattaattcactgggtttttaacac-nnnnnnnnatttccaattcaacccttggcattattattgtatc |
211 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
54536417 |
aatggatgagtacgtttcaacttccacaggatattaattcactgggtttttaacactttttttttatttccaattcaacccttggcattattattgtatc |
54536318 |
T |
 |
| Q |
212 |
attttattgttaattaattaatagtatatgaatatgatgctgtattaaacacgc |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54536317 |
attttattgttaattaattaatagtatatgaatatgatgctgtattaaacacgc |
54536264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University