View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18604_low_17 (Length: 254)
Name: NF18604_low_17
Description: NF18604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18604_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 19 - 244
Target Start/End: Original strand, 35560648 - 35560872
Alignment:
| Q |
19 |
cattttactatcagagacttttattgaagaataattgttttttcttttcaggttggcctttgaaatttaataatgcaaggatcatcgtcatcattataaa |
118 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35560648 |
cattttactatcagagacttctattgaagaataattgttttttcttttcaggttggcctttgaaatttaataatgcaaggatcatcgtcatcattataaa |
35560747 |
T |
|
| Q |
119 |
attttgtcaaaataaaaaca-tcatcatcaccatcatagaataatttttctttnnnnnnnnnnntcagagaataattttcttacttgataattagccagg |
217 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
35560748 |
attttgtcaaaataaaaacagtcatcatcatcatcatagaataatttttcttt--aaaaaaaaatcatagaataattttcttacttgagaattagccagg |
35560845 |
T |
|
| Q |
218 |
tcacgtgtctgcaatgtggcacctatg |
244 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
35560846 |
tcacgtgtctgcaatgtggcacctatg |
35560872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University