View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18604_low_18 (Length: 249)
Name: NF18604_low_18
Description: NF18604
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18604_low_18 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 185 - 249
Target Start/End: Original strand, 45592373 - 45592437
Alignment:
| Q |
185 |
tcagtaatatttgtttttaagtcaccttcagttcgaccgcggtataatcacattgatataattat |
249 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45592373 |
tcagtaatatttgtttgtaagtcaccttcagttcgaccgcggtataatcacattgatataattat |
45592437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 43 - 81
Target Start/End: Original strand, 45592330 - 45592368
Alignment:
| Q |
43 |
attagcttagttttgtaatcagtgcgttggcctgaacat |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
45592330 |
attagcttagttttgtaatcagtgcgttggtccgaacat |
45592368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 75 - 124
Target Start/End: Complemental strand, 27484909 - 27484860
Alignment:
| Q |
75 |
tgaacatgagtttataagtgagatgaatcctcaccttacaaaccggtttt |
124 |
Q |
| |
|
|||||||| ||||||||||||||| ||| ||||| ||| ||||||||||| |
|
|
| T |
27484909 |
tgaacatgtgtttataagtgagatcaattctcactttataaaccggtttt |
27484860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 100 - 145
Target Start/End: Original strand, 33456021 - 33456066
Alignment:
| Q |
100 |
aatcctcaccttacaaaccggttttatcagtttgagttcggcccaa |
145 |
Q |
| |
|
||||||||||||||||||||||||| | || ||||||| ||||||| |
|
|
| T |
33456021 |
aatcctcaccttacaaaccggttttgtaaggttgagttaggcccaa |
33456066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 78 - 150
Target Start/End: Original strand, 51610 - 51682
Alignment:
| Q |
78 |
acatgagtttataagtgagatgaatcctcaccttacaaaccggttttatcagtttgagttcggcccaatataa |
150 |
Q |
| |
|
||||| |||| |||||||| | ||||||| ||||||||||||||||| | || |||||| |||| ||||||| |
|
|
| T |
51610 |
acatgggtttgtaagtgagttcaatcctcgccttacaaaccggttttgtaaggatgagttaggcctaatataa |
51682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University