View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18605_high_12 (Length: 247)
Name: NF18605_high_12
Description: NF18605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18605_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 36 - 242
Target Start/End: Original strand, 41530960 - 41531166
Alignment:
| Q |
36 |
cggtacattcaaaatcagcattaatcaatttgaaacatgacaatgcaggttaaatgataagctgtgatgggacnnnnnnnnttatgtccaagaattttga |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
41530960 |
cggtacattcaaaatcagcattaatcaatttgaaacatgacaatgcaggttaaatgataagctgtgataggacaaaaaaaattatgtccaagaattttga |
41531059 |
T |
 |
| Q |
136 |
tggagtttgtgcttacaagtgtaggcttggaaaatatatgccttccacaccattgcagagaacattgaccttatttgaaagcactaactgctcacaggtt |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
41531060 |
tggagtttgtgcttacaagtgtaggcttggaaaatatatgccttccacaccattgcagagaacattgaccttatttgaaagcactaactgctcactgttt |
41531159 |
T |
 |
| Q |
236 |
ctgctcg |
242 |
Q |
| |
|
||||||| |
|
|
| T |
41531160 |
ctgctcg |
41531166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 128 - 224
Target Start/End: Complemental strand, 15626219 - 15626123
Alignment:
| Q |
128 |
aattttgatggagtttgtgcttacaagtgtaggcttggaaaatatatgccttccacaccattgcagagaacattgaccttatttgaaagcactaact |
224 |
Q |
| |
|
|||||||| |||||| |||||||||||| |||||||||||||||||||||||||||| ||||||||||||| ||||||| |||| ||| ||||||| |
|
|
| T |
15626219 |
aattttgaatgagtttatgcttacaagtgaaggcttggaaaatatatgccttccacactattgcagagaacagtgaccttctttggaagtactaact |
15626123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 57; Significance: 6e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 137 - 221
Target Start/End: Complemental strand, 816656 - 816572
Alignment:
| Q |
137 |
ggagtttgtgcttacaagtgtaggcttggaaaatatatgccttccacaccattgcagagaacattgaccttatttgaaagcacta |
221 |
Q |
| |
|
||||||| |||||||||||| || | ||||||||||||||||||||||||||||||||||||| ||||||| |||| |||||||| |
|
|
| T |
816656 |
ggagtttatgcttacaagtgaagacatggaaaatatatgccttccacaccattgcagagaacagtgaccttctttggaagcacta |
816572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University