View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18605_low_12 (Length: 307)
Name: NF18605_low_12
Description: NF18605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18605_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 45 - 285
Target Start/End: Original strand, 4197776 - 4198010
Alignment:
| Q |
45 |
aatataatcaaagtaggaagaagcttcagtgatataaactatttgtgcagtcactcaaaatagcacaattataggcagaaacaaataactaattaaccaa |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
4197776 |
aatataatcaaagtaggaagaagcttcagtgatataaactatttgtgcagtcactcaaaatagcacaattataggcagaaacaaa--------taaccaa |
4197867 |
T |
 |
| Q |
145 |
tttcaag-aaaaaattaaaattattccttgtcatcaaaataacaagtaacaagtgtaacnnnnnnnngaagtaacaaccttaagatttgggccaaggctt |
243 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4197868 |
tttcaagaaaaaaattaaaattattccttgtcatcaaaataacaagtaacaagtgtaacaaaaaaaagaagtaacaaccttaagatttgggccaaggctt |
4197967 |
T |
 |
| Q |
244 |
ttactctcaattgccttttacaccaaacacatg-ctctcatgt |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4197968 |
ttactctcaattgccttttacaccaaacacatgcctctcatgt |
4198010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 4197714 - 4197754
Alignment:
| Q |
1 |
atcaaggttttaatggtgtgatgtgttggcattctcaacta |
41 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4197714 |
atcaaggttttaatggtgtgatgtgttgacattctcaacta |
4197754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University