View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18605_low_14 (Length: 284)
Name: NF18605_low_14
Description: NF18605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18605_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 35 - 265
Target Start/End: Original strand, 43539939 - 43540168
Alignment:
| Q |
35 |
atgaacatcaaaattgtgcatatgcctatgtatcaaagaatacatccaaatagctgaatttgaaaatgatatgtgcatggcgaaaatgttgaatatgata |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43539939 |
atgaacatcaaaattgtgcatatgcctatgtatcaa-gaatacatcccaatagctgaatttgaaaatgatatgtgcatggtgaaaatgttgaatatgata |
43540037 |
T |
|
| Q |
135 |
gttgggatgcttggaagaagccagctgaccccacaacaagtaagacgttacctgaatgaagttaacaataagaggaaagatcttttgcagaagtacatcc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43540038 |
gttgggatgcttggaagaagccagctgaccccacaacaagtaagacgttacctgaatgaagttaacaataagaggaaagatcttttgcagaagtacatcc |
43540137 |
T |
|
| Q |
235 |
agctgagcactgaagccaaggtaattaaagt |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
43540138 |
agctgagcactgaagccaaggtaattaaagt |
43540168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University