View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18605_low_19 (Length: 216)
Name: NF18605_low_19
Description: NF18605
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18605_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 12 - 199
Target Start/End: Original strand, 2371068 - 2371252
Alignment:
| Q |
12 |
atgaagttataacaaccaacttaaggattttgatcaacaagaggatgaggcaattactcacttcatagaaagaatattcataaagttccaaaagaggaat |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
2371068 |
atgaagttataacaaccaacttaaggattttgatcaacaagaggatgaggcaattactcacttcatagaaaga---ttcataaagttccaaaagagcaat |
2371164 |
T |
|
| Q |
112 |
gtgttgccttggttgtggataaccactataaaaaacatgtgaattatgatgattttgttaaggtgtttttgttaaccgccactattac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2371165 |
gtgttgccttggttgtggataaccactataaaaaacatgtgaattatgatgattttgttaaggtgtttttgttaaccgccactattac |
2371252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 101 - 137
Target Start/End: Complemental strand, 12128267 - 12128231
Alignment:
| Q |
101 |
aaaagaggaatgtgttgccttggttgtggataaccac |
137 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12128267 |
aaaagagtaatgtgttgccttggttgtggataaccac |
12128231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University