View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18606_low_13 (Length: 280)
Name: NF18606_low_13
Description: NF18606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18606_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 21 - 268
Target Start/End: Original strand, 9383446 - 9383693
Alignment:
| Q |
21 |
gtatggtatcagaattatacatggcttatgtattccaatactccaattttttccttctgtcaggctgaagaatcaccttccactagagaaatgccatgat |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9383446 |
gtatggtatcagaattatacatggcttatgtattccaatactccaattttttccttctgtcaggctgaagaatcaccttccactacagaaatgccatgat |
9383545 |
T |
 |
| Q |
121 |
ctatacttgtttctcagagcacaatcttatttgaaattaaactcacattaaggtacaaagtctatttgctatatgagatattactattggttgttaaaaa |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9383546 |
ctatacttgtttctcagagcacaatcttatttgaaattaaactcacattaaggtacagagtctatttgctatatgagatatcactattggttgttaaaaa |
9383645 |
T |
 |
| Q |
221 |
tctcgatattacttttgattgtcttctatttttcactgatgctatttt |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
9383646 |
tctcgatattacttttgattgtcttctatttttcagtgatactatttt |
9383693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University