View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18606_low_21 (Length: 219)
Name: NF18606_low_21
Description: NF18606
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18606_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 63 - 142
Target Start/End: Complemental strand, 8467399 - 8467320
Alignment:
| Q |
63 |
aactgaaactatgtaatatagtatgtgtgaatatgataactgttttttggcctgaagtctctttgtagtactcgcagcta |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8467399 |
aactgaaactatgtaatatagtatgtgtgaatatgataactgttttttggcctgaagtctctttgtagtactcgcagcta |
8467320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 158 - 203
Target Start/End: Complemental strand, 8467276 - 8467231
Alignment:
| Q |
158 |
gagacatccttttgctatttttgttctgatttaaattgtgggatga |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8467276 |
gagacatccttttgctatttttgttctgatttaaattgtgggatga |
8467231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University