View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18607_high_16 (Length: 244)
Name: NF18607_high_16
Description: NF18607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18607_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 12 - 223
Target Start/End: Original strand, 8794173 - 8794384
Alignment:
| Q |
12 |
gagatgaagtaggaaatgattctgttttggtaagacagggtagtaaggagcatattctttttattttggacccaatggttcaacaggccaacccttaaca |
111 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||| |||||||||||| |
|
|
| T |
8794173 |
gagatgaagtaggaaatgattctactttggtaagacagggtagtaaggagcatattctttttattttggatccaatggctcaacaggtcaacccttaaca |
8794272 |
T |
 |
| Q |
112 |
tatgccttcagttgttgaggagaacggtgagtagcacaactcccgtttgaatggtctgattgaattagcagtgcatgagcatgaaaccatgggaagaatt |
211 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
8794273 |
tatgccttcagttgttgaggagaacgctgagtagcacaactcccgtttgaatggtctgattgaattagcagttcatgagcatgaaatcatgggaagaatt |
8794372 |
T |
 |
| Q |
212 |
gatacaatgggt |
223 |
Q |
| |
|
|||||||||||| |
|
|
| T |
8794373 |
gatacaatgggt |
8794384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University