View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18607_low_11 (Length: 409)
Name: NF18607_low_11
Description: NF18607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18607_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 373; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 373; E-Value: 0
Query Start/End: Original strand, 7 - 399
Target Start/End: Complemental strand, 50235386 - 50234994
Alignment:
| Q |
7 |
gaagcaaaggcaataacagcaccaatgaatctgaatgtggcacgagaagaggcactaggagcaggagcaggtgcatcaccaaaactctcaggtgactcag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50235386 |
gaagcaaaggcaataacagcaccaatgaatctgaatgtggcacgagaagaggcactaggagcaggagcaggtgcatcaccaaaactctcaggtgactcag |
50235287 |
T |
|
| Q |
107 |
caatcaccacagaaggtgatgctgctggtgttgtaacctgaccggcaccggatgttggcacagctgctggtgttgcaacctcaccggcactggatgttga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50235286 |
caatcaccacagaaggtgatgctgctggtgttgtaacctgaccggcaccggatgctggcacagctgctggtgttgcaacctcaccggcactggatgttga |
50235187 |
T |
|
| Q |
207 |
cacagctgcaggtgttgctggttttgatagtgttgctggagttgccggagctgaagcaccaaccttaacaattggctgtgaaacctggagaattgaaaca |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50235186 |
cacagctgcaggtgttgctggttttgatagtgttgctggagttgctggagctgaagcaccaaccttaacaattggctgtgaaacctggagaattgaaaca |
50235087 |
T |
|
| Q |
307 |
acgcctggttcagcctcagtgctttgaacaagcgtggcatcgaaggttgagccttcaacagcagacctcaatgccctttcaccttcattaata |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| ||||||||||||||||| |
|
|
| T |
50235086 |
acgcctggttcagcctcagtgctttgaacaagcgtggcatcgaaggttgagccttcaacagcagaactaaatgccatttcaccttcattaata |
50234994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University