View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18607_low_17 (Length: 305)
Name: NF18607_low_17
Description: NF18607
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18607_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 11 - 285
Target Start/End: Original strand, 33448793 - 33449067
Alignment:
| Q |
11 |
cacagacagtggcaaatcttttacatgcaagctttgccttgatacaacggtacataagatcatttcctttttctttaacattgataggagtnnnnnnnnn |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33448793 |
cacagacagtggcaaatcttttacatgcaagctttgccttgatacaagggtacataagatcatttcctttttctttaacattgataggagttatattata |
33448892 |
T |
|
| Q |
111 |
nnnnnnnncctgaacatgatatatgagattgatttacacaattgcttcattttattacttatttataaggctcgatttacaggtagagttggcatacatt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |||||||||||||||||||||| ||| |
|
|
| T |
33448893 |
tattatatcctgaacatgatatatgagattgatttacacaattgcttcactttattacttatttataagcctcaatttacaggtagagttggcatatatt |
33448992 |
T |
|
| Q |
211 |
gatcatggtggtattcttccatatgttatccgcattttgattaagcaatgatatattttgtttttcccttcctag |
285 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33448993 |
gatcatggtggtattcttccatatgttatccgcattttgattaagcaatgatatattttgtttttccctttctag |
33449067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University