View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18608_low_10 (Length: 305)
Name: NF18608_low_10
Description: NF18608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18608_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 54 - 210
Target Start/End: Complemental strand, 32964565 - 32964408
Alignment:
| Q |
54 |
gagaaagaatgaattaggggataatgaagggttactctttcaaggtttgggagaaggagattttctgtaacannnnnnngacacatgagagtaatggtgc |
153 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32964565 |
gagagagaatgaattaggggataatgaagggttactctttcaaggtttgggagaaggagattttctgtaacatttttttgacacatgagagtaatggtgc |
32964466 |
T |
|
| Q |
154 |
atgccgtacataatttctttagaattgcaccacacaaattttc-tttaacacttgaca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32964465 |
atgccgtacataatttctttagaattgcaccacacaaattttcttttaacacttgaca |
32964408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 18 - 49
Target Start/End: Complemental strand, 32964624 - 32964593
Alignment:
| Q |
18 |
catgagaaaattgatcaaattaagggctggga |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32964624 |
catgagaaaattgatcaaattaagggctggga |
32964593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 262
Target Start/End: Complemental strand, 32964405 - 32964372
Alignment:
| Q |
229 |
tgagtgtgaatgaaatcaaaataatgttaacaat |
262 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
32964405 |
tgagtgtgaatgaaatcaaaataatgtcaacaat |
32964372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University