View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18608_low_13 (Length: 246)
Name: NF18608_low_13
Description: NF18608
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18608_low_13 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 10 - 246
Target Start/End: Complemental strand, 27430907 - 27430671
Alignment:
| Q |
10 |
catcatcattgtcatcatatccactacatgtgatgaaaggactaggttgtaattatgccctctcatttttatttattttgttgtttcctctagttattat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27430907 |
catcatcattgtcatcatatccactacatgtgatgaaaggactaggttgtaattatgccctctcatttttatttattttgttgtttcctctagttattat |
27430808 |
T |
|
| Q |
110 |
ggttttggctgacacagtaaaattatttgattgtttcatagtcctacttggttttgagnnnnnnnggtacaattagaaaacttatccaattatgtaatta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27430807 |
ggttttggctgacacagtaaaattatttgattgtttcatagtcctacttggttttgagtttttttggtacaattagaaaacttatccaattatgtaatta |
27430708 |
T |
|
| Q |
210 |
tttttcagaaaagtttcacaaacatgggagaaggagt |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27430707 |
tttttcagaaaagtttcacaaacatgggagaaggagt |
27430671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University