View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1860_high_26 (Length: 305)
Name: NF1860_high_26
Description: NF1860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1860_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 18 - 299
Target Start/End: Original strand, 32906112 - 32906393
Alignment:
| Q |
18 |
cgagctagataacacttgcttttatgactgaattccattaatccaaaacataatttatgtttaatcattgtgttaagagtggtgtatatttaattaagaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32906112 |
cgagctagataacacttgcttttatgactgaattccattaatcgaaaacataatttatgtttaatcattgtgttaagagtggtgtatatttaattaagaa |
32906211 |
T |
 |
| Q |
118 |
aggttaggttagcgtatgaatgcgttaaaatgaaatatgcagacaaattcttagcctcgagtcaaggactctcattctctctttccccgtcacaatcacg |
217 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32906212 |
aggttaagttagcgtatgaatgcgttaaaatgaaatatgcagacaaattcttagcctcgagtcaaggactctcattctctctttccccgtcacaatcacg |
32906311 |
T |
 |
| Q |
218 |
gacatgtgcactaaccacaatgtattctgtatccatcccttttatgcgtacgtctttttatatttattccctcctttgcttc |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32906312 |
gacatgtgcactaaccacaatgtattctgtatccatcccttttatgcgtacgtctttttatatttattccctcctttgcttc |
32906393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University