View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1860_high_34 (Length: 285)
Name: NF1860_high_34
Description: NF1860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1860_high_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 271
Target Start/End: Original strand, 34395378 - 34395648
Alignment:
| Q |
1 |
gaaaatgaaagcaagactcgagtgcacatttgagactttttgaagaaaaaataaatgaatgaggcacaaatgaagagactatttgaagggttatgtggtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34395378 |
gaaaatgaaagcaagactcgagtgcacatttgagactttttgaagaaaaaataaatgaatgaggcacaaatgaagagactatttgaagggttatgtggtg |
34395477 |
T |
 |
| Q |
101 |
ttctagaatttgaactctttacgtctatgcttggtttatttaaaaaatgataaatatatgctgaactgcatttcttctgctattttgatggatctttgct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34395478 |
ttctagaatttgaactctttacgtctatgcttggtttatttaaaaaatgataaatatatgctgaaatgcatttcttctgctattttgatggatctttgct |
34395577 |
T |
 |
| Q |
201 |
tgtaaacttcaaattagagaatgtatgtgttgatgcttatgggattcgtagaaaatccgatatgcatgttg |
271 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34395578 |
tgtaaacttcaaattagaaaatgtatgtgttgatgcttatgggattcatagaaaatccgatatgcatgttg |
34395648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University