View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1860_high_43 (Length: 240)
Name: NF1860_high_43
Description: NF1860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1860_high_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 30 - 222
Target Start/End: Original strand, 7461456 - 7461643
Alignment:
| Q |
30 |
tatattactatagtgttttgtttttatttgtatcaacacaacactagtaacgtcaatttagggcaagcatgctaccatgtttcttctctggtggtcttca |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
7461456 |
tatattactatagtgttttgtttttatttgtatcaacacaacactagtaacgtcaatttagggcaagcatgctaccatgtttcttctctggtggtcttga |
7461555 |
T |
 |
| Q |
130 |
tannnnnnnnattcactatattgttgttatgactttgtttaattaaaaaagttgtttgcttagtttaatcccctaaatgttgaaagagagaat |
222 |
Q |
| |
|
| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7461556 |
ttttttttttattcactatattgttgtta-----ttgtttaattaaaaaagttgtttgcttagtttaataccctaaatgttgaaagagagaat |
7461643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 30 - 127
Target Start/End: Original strand, 7446468 - 7446565
Alignment:
| Q |
30 |
tatattactatagtgttttgtttttatttgtatcaacacaacactagtaacgtcaatttagggcaagcatgctaccatgtttcttctctggtggtctt |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7446468 |
tatattactatagtgttttgtttttatttgtctcaacacaacaccagtaacgtcaatttagggcaagcatgttaccatgtttcttctctggtggtctt |
7446565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 211
Target Start/End: Original strand, 7446593 - 7446631
Alignment:
| Q |
173 |
taaaaaagttgtttgcttagtttaatcccctaaatgttg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7446593 |
taaaaaagttgtttgcttagtttaatccactaaatgttg |
7446631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University