View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1860_high_50 (Length: 237)

Name: NF1860_high_50
Description: NF1860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1860_high_50
NF1860_high_50
[»] chr2 (1 HSPs)
chr2 (1-221)||(36017141-36017361)
[»] chr4 (1 HSPs)
chr4 (1-219)||(20137629-20137847)


Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 36017141 - 36017361
Alignment:
1 taatccataaagctcggctgcacgtgcgctggcgatagccgcagtgtcgcggagattgttagtcgcaacaaactccgcggcacctgcagtatcatcaact 100  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |||||||||||||| ||||||    
36017141 taatccataaagctcggctgcacgtgcgctggcgatagcagcagtgtcgcggagattgttagttgcaacaaactccgcagcacctgcagtatcgtcaact 36017240  T
101 gcttcacgtgcgacgttgaggccgagttttgttaatgtgtgttcgcattgagataaagcttgtggatgagatatgacacgtgtcagatattcttttctga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
36017241 gcttcacgtgcgacgttgaggccgagttttgttaatgtgtgttcgcattgagataaagcttgtggatgagagatgacacgtgtcagatattcttttctga 36017340  T
201 ttccggggagagcgaggagac 221  Q
    |||||||||||||||||||||    
36017341 ttccggggagagcgaggagac 36017361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 20137847 - 20137629
Alignment:
1 taatccataaagctcggctgcacgtgcgctggcgatagccgcagtgtcgcggagattgttagtcgcaacaaactccgcggcacctgcagtatcatcaact 100  Q
    |||||| |||||||| || || ||||||||||||||||| |||||||||||||| || || |  | || ||||||||||||||| || ||||| |||||     
20137847 taatccgtaaagctctgcagcgcgtgcgctggcgatagcagcagtgtcgcggaggttatttgcagtaataaactccgcggcaccagctgtatcgtcaacg 20137748  T
101 gcttcacgtgcgacgttgaggccgagttttgttaatgtgtgttcgcattgagataaagcttgtggatgagatatgacacgtgtcagatattcttttctga 200  Q
    || ||||| || |||||||||||||| |||||||| |||| ||||||||||| ||| ||||||||||| || || || ||||| | ||||||||||| ||    
20137747 gcctcacgcgctacgttgaggccgagctttgttaacgtgttttcgcattgagctaatgcttgtggatgcgaaatcacgcgtgttaaatattcttttcgga 20137648  T
201 ttccggggagagcgaggag 219  Q
     ||| || || ||||||||    
20137647 ctcctggaagtgcgaggag 20137629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University