View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1860_high_52 (Length: 232)
Name: NF1860_high_52
Description: NF1860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1860_high_52 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 13773842 - 13773618
Alignment:
| Q |
1 |
tatttcactataatgggtgctcatnnnnnnntttcacacttatattttctattattttgcttaattatgcgtacaattttgtacgagat-----aaatct |
95 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| | |||| |
|
|
| T |
13773842 |
tatttcactataatggtggctcataaaaaaatttcacacttttattttctattattttgcttaattatgtgtacaattttgtacgagatctttaatatct |
13773743 |
T |
|
| Q |
96 |
tttcatcgtaaagaaaacaattcttttaacaaaacaattacatatggcaaagcttagcccacttggtttgttcgatggtattgacttaggagttaggacc |
195 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| | ||||| ||||| |
|
|
| T |
13773742 |
tttcatcgtaaagaaaacaattcttgtaacaaaacaattacatatggcaaagcttagcccacttggttggtccgatggtattgactcaagagtttggacc |
13773643 |
T |
|
| Q |
196 |
cgaaagtgtgctcatctttaagatt |
220 |
Q |
| |
|
||| ||||||||||| ||||||||| |
|
|
| T |
13773642 |
cgagagtgtgctcatttttaagatt |
13773618 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University