View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1860_low_2 (Length: 559)

Name: NF1860_low_2
Description: NF1860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1860_low_2
NF1860_low_2
[»] chr1 (2 HSPs)
chr1 (384-551)||(29500293-29500457)
chr1 (414-482)||(31123283-31123351)
[»] chr6 (1 HSPs)
chr6 (384-544)||(14526766-14526926)
[»] chr8 (2 HSPs)
chr8 (384-544)||(40499441-40499601)
chr8 (429-482)||(39037402-39037456)
[»] chr2 (7 HSPs)
chr2 (147-266)||(42836693-42836812)
chr2 (19-81)||(42836562-42836624)
chr2 (412-443)||(23889595-23889626)
chr2 (412-443)||(23893671-23893702)
chr2 (384-437)||(5568385-5568439)
chr2 (384-482)||(11361771-11361868)
chr2 (414-443)||(23899196-23899225)
[»] chr7 (2 HSPs)
chr7 (384-457)||(12489534-12489606)
chr7 (414-483)||(43016466-43016535)
[»] chr3 (2 HSPs)
chr3 (406-482)||(35495329-35495405)
chr3 (412-443)||(35596328-35596359)
[»] chr4 (2 HSPs)
chr4 (414-482)||(23112156-23112224)
chr4 (412-443)||(37877979-37878010)


Alignment Details
Target: chr1 (Bit Score: 126; Significance: 1e-64; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 126; E-Value: 1e-64
Query Start/End: Original strand, 384 - 551
Target Start/End: Complemental strand, 29500457 - 29500293
Alignment:
Q  384 gatacatagaccactctttttcatacacctctttgtaccactgctgatgtggcaggggtagtgtggtaatttcacgcgctagggatagtttggtagtttt 483  Q
    |||||||||||||||||||| |||||| |||||||||||||||   |||||||||||||||| ||||||||||||| | |||||||||||||||||||||    
T  29500457 gatacatagaccactcttttccatacatctctttgtaccactg---atgtggcaggggtagtttggtaatttcacgtgttagggatagtttggtagtttt 29500361  T
Q  484 cacaatctcttcctcttctccgttcgcagatccgttctgtctccatctcaatcccactctttcatctc 551  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||    
T  29500360 cacaatctcttcctcttctctgttcgcagatccgttctgtctccatctcaatcccactcttccatctc 29500293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 414 - 482
Target Start/End: Original strand, 31123283 - 31123351
Alignment:
Q  414 ctttgtaccactgctgatgtggcaggggtagtgtggtaatttcacgcgctagggatagtttggtagttt 482  Q
    ||||||| ||||||||||||||||| |||||| |||||||||||| |  ||||| ||||||||||||||    
T  31123283 ctttgtatcactgctgatgtggcagaggtagtttggtaatttcacacaataggggtagtttggtagttt 31123351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 105; Significance: 3e-52; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 384 - 544
Target Start/End: Complemental strand, 14526926 - 14526766
Alignment:
Q  384 gatacatagaccactctttttcatacacctctttgtaccactgctgatgtggcaggggtagtgtggtaatttcacgcgctagggatagtttggtagtttt 483  Q
    ||||||||||||||||||||  ||||||| |||||||||| || ||||||  |||||||||| ||||||||||||||||||| ||||||||| |||||||    
T  14526926 gatacatagaccactcttttctatacacccctttgtaccagtgttgatgttacaggggtagtttggtaatttcacgcgctagtgatagtttgatagtttt 14526827  T
Q  484 cacaatctcttcctcttctccgttcgcagatccgttctgtctccatctcaatcccactctt 544  Q
    | |||||||||||||||||| |||| |||||||||||||||||| ||||||||||||||||    
T  14526826 cgcaatctcttcctcttctctgttcacagatccgttctgtctccgtctcaatcccactctt 14526766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 97; Significance: 2e-47; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 384 - 544
Target Start/End: Original strand, 40499441 - 40499601
Alignment:
Q  384 gatacatagaccactctttttcatacacctctttgtaccactgctgatgtggcaggggtagtgtggtaatttcacgcgctagggatagtttggtagtttt 483  Q
    ||||||||||||||||||||  |||| || ||||| |||||||||||||||||||||||||| || |||||||||||| |||||||||||||||||||||    
T  40499441 gatacatagaccactcttttctatacgcccctttgcaccactgctgatgtggcaggggtagtttgataatttcacgcgatagggatagtttggtagtttt 40499540  T
Q  484 cacaatctcttcctcttctccgttcgcagatccgttctgtctccatctcaatcccactctt 544  Q
     |||||||||| |||||||  |||| |||||| ||||| ||||| ||||||||||||||||    
T  40499541 tacaatctctttctcttctttgttcacagatctgttctctctccgtctcaatcccactctt 40499601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 429 - 482
Target Start/End: Complemental strand, 39037456 - 39037402
Alignment:
Q  429 gatgtggcaggggtagtgtggtaatttcacgcgct-agggatagtttggtagttt 482  Q
    ||||||||| ||||||| ||||||||||||||| | |||| ||||||||||||||    
T  39037456 gatgtggcaagggtagtttggtaatttcacgcgataaggggtagtttggtagttt 39037402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 95; Significance: 3e-46; HSPs: 7)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 147 - 266
Target Start/End: Original strand, 42836693 - 42836812
Alignment:
Q  147 ctagcatttagacgggtagatggaccaccccgtttgtccacttttcttattgcgataatgattacaaattaggaacaacaannnnnnnatgaaattttaa 246  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||       ||||||||||||    
T  42836693 ctagcatttagacgggtagatggaccaccccgtttgtccacttttcttattgcgataatgattataaattaggaacaacaatttttttatgaaattttaa 42836792  T
Q  247 ataaaattattgattttgat 266  Q
    ||||||||||||||||||||    
T  42836793 ataaaattattgattttgat 42836812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 19 - 81
Target Start/End: Original strand, 42836562 - 42836624
Alignment:
Q  19 cgtgtaactacgatcccaacaaaaagctttgtgtaaggaggtggtacaacgacgaacatccac 81  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  42836562 cgtgtaactacgatcccaacaaaaagctttgtgtaaggaggtggtacaacaacgaacatccac 42836624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 443
Target Start/End: Complemental strand, 23889626 - 23889595
Alignment:
Q  412 ctctttgtaccactgctgatgtggcaggggta 443  Q
    ||||||||||||||||||||||||||||||||    
T  23889626 ctctttgtaccactgctgatgtggcaggggta 23889595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 443
Target Start/End: Complemental strand, 23893702 - 23893671
Alignment:
Q  412 ctctttgtaccactgctgatgtggcaggggta 443  Q
    ||||||||||||||||||||||||||||||||    
T  23893702 ctctttgtaccactgctgatgtggcaggggta 23893671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 384 - 437
Target Start/End: Complemental strand, 5568439 - 5568385
Alignment:
Q  384 gatacatagaccactct-ttttcatacacctctttgtaccactgctgatgtggca 437  Q
    |||||||  |||||||| |||| ||||||| ||||||||||||||||||||||||    
T  5568439 gatacatgtaccactctcttttaatacacccctttgtaccactgctgatgtggca 5568385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 384 - 482
Target Start/End: Complemental strand, 11361868 - 11361771
Alignment:
Q  384 gatacatagaccactctttttcatacacctctttgtaccactgctgatgtggcaggggtagtgtggtaatttcacgcgctagggatagtttggtagttt 482  Q
    ||||||||||||||| ||  | || |||| |||| ||||||||||||||||||||||  ||| ||||| ||||||||  || || ||||||| ||||||    
T  11361868 gatacatagaccacttttaat-atccacccctttataccactgctgatgtggcagggacagtttggtagtttcacgcaatatgggtagtttgatagttt 11361771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 414 - 443
Target Start/End: Complemental strand, 23899225 - 23899196
Alignment:
Q  414 ctttgtaccactgctgatgtggcaggggta 443  Q
    ||||||||||||||||||||||||||||||    
T  23899225 ctttgtaccactgctgatgtggcaggggta 23899196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 46; Significance: 6e-17; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 384 - 457
Target Start/End: Original strand, 12489534 - 12489606
Alignment:
Q  384 gatacatagaccactctttttcatacacctctttgtaccactgctgatgtggcaggggtagtgtggtaatttca 457  Q
    ||||||||||||||| ||  | ||||||| |||||||||||||||||||||||||||||||| |||||||||||    
T  12489534 gatacatagaccacttttaat-atacacccctttgtaccactgctgatgtggcaggggtagtttggtaatttca 12489606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 414 - 483
Target Start/End: Original strand, 43016466 - 43016535
Alignment:
Q  414 ctttgtaccactgctgatgtggcaggggtagtgtggtaatttcacgcgctagggatagtttggtagtttt 483  Q
    |||||||||||||||||||||||||||||||  || ||||||||   ||||||| |||||||||||||||    
T  43016466 ctttgtaccactgctgatgtggcaggggtagattgctaatttcatatgctaggggtagtttggtagtttt 43016535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 406 - 482
Target Start/End: Original strand, 35495329 - 35495405
Alignment:
Q  406 atacacctctttgtaccactgctgatgtggcaggggtagtgtggtaatttcacgcgctagggatagtttggtagttt 482  Q
    ||||||| ||||| |||||||||||||||| ||||||||| ||||||||||| ||  ||| | ||||||||||||||    
T  35495329 atacacccctttgcaccactgctgatgtggtaggggtagtttggtaatttcatgcaatagaggtagtttggtagttt 35495405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 443
Target Start/End: Complemental strand, 35596359 - 35596328
Alignment:
Q  412 ctctttgtaccactgctgatgtggcaggggta 443  Q
    ||||||||||||||||||||||||||||||||    
T  35596359 ctctttgtaccactgctgatgtggcaggggta 35596328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.00000000001; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 414 - 482
Target Start/End: Original strand, 23112156 - 23112224
Alignment:
Q  414 ctttgtaccactgctgatgtggcaggggtagtgtggtaatttcacgcgctagggatagtttggtagttt 482  Q
    |||||||||||||||||||||| |||||| || || |||||||||||  ||| | ||||||||||||||    
T  23112156 ctttgtaccactgctgatgtggtaggggtggtttgataatttcacgcaatagaggtagtttggtagttt 23112224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 412 - 443
Target Start/End: Original strand, 37877979 - 37878010
Alignment:
Q  412 ctctttgtaccactgctgatgtggcaggggta 443  Q
    ||||||||||||||||||||||||||||||||    
T  37877979 ctctttgtaccactgctgatgtggcaggggta 37878010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University