View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1860_low_27 (Length: 305)
Name: NF1860_low_27
Description: NF1860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1860_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 23 - 288
Target Start/End: Original strand, 31731769 - 31732034
Alignment:
| Q |
23 |
ttgttttgaaaaagacaccagacattaatctattggttcaaaattgcatatttttattggtgttttgtggaccacaatatatggtggctcacatcacata |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31731769 |
ttgttttgaaaaagacaccagacattaatctattggttcaaaattgcatatttttattggtgttttgtggaccacaatatatggtggctcccatcacata |
31731868 |
T |
 |
| Q |
123 |
taaacatcacatgaattaaggaggagaaaacgattggtttcgttttctgctgccaatgaatacttatagtacattctctaatcttccttcatcaaattaa |
222 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
31731869 |
taaacatcgcatgaattaaggaggagaaaacgattggtttcgttttctgctgccaatgaatacttatagtacattctctaatcttcctgcatcaaattaa |
31731968 |
T |
 |
| Q |
223 |
ttaaatggctagttggaccattgtgttgtcacaccttgaattgaactagatatcatgtgatacttc |
288 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31731969 |
ttaaatggctagttggaccatggtgttgtcacaccttgaattgaactagatatcatgtgatacttc |
31732034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University