View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1860_low_38 (Length: 250)
Name: NF1860_low_38
Description: NF1860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1860_low_38 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 12 - 250
Target Start/End: Original strand, 40092095 - 40092333
Alignment:
| Q |
12 |
aagaaagacaacaaaagttaaggggaagaaaagtcttcacacctttcctttgagatcaagagcctcagcagtaccaatctgctcaagttttttctcaatt |
111 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40092095 |
aagaaagacaagaaaagttaaggggaaaaaaagtcttcacacctttcctttgagatcaagagcctcagcagtaccaatctgctcaagttttttctcaatt |
40092194 |
T |
 |
| Q |
112 |
gtaacatccactctactgatgtagaaagctgctgcacttgaaaccttggagagatcagtgttactagaagcttcaagaccatccaagtaagcattaataa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40092195 |
gtaacatccactctactgatgtagaaagctgctgcacttgaaaccttggagagatcagtgttactagaagcttcaagaccatccaagtaagcattaataa |
40092294 |
T |
 |
| Q |
212 |
ctgcttcatatatagggagagagaatatgagctgttcaa |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40092295 |
ctgcttcatatatagggagagagaatatgagctgttcaa |
40092333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University