View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1860_low_44 (Length: 240)
Name: NF1860_low_44
Description: NF1860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1860_low_44 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 116 - 223
Target Start/End: Original strand, 6858370 - 6858477
Alignment:
| Q |
116 |
cctccacttcgaaattccatatcaaacccactcactgaactcgaccgttgaagtctcactgtccatttcacacttcaaaacctaagcttatatcatcatc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6858370 |
cctccacttcgaaattccatatcaaacccactcactgaacttgaccgttgaagtctcactgtccatttcacacttcaaaacctaagcttatatcatcatc |
6858469 |
T |
 |
| Q |
216 |
atcaatgc |
223 |
Q |
| |
|
|||||||| |
|
|
| T |
6858470 |
atcaatgc |
6858477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University