View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1860_low_48 (Length: 237)
Name: NF1860_low_48
Description: NF1860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1860_low_48 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 48982477 - 48982702
Alignment:
| Q |
1 |
cgagaataaaattaagtgtagttgataggagaatattatgttgaatgtatgataaaattagacgaaattggattaagaatgacaatattaaatnnnnnnn |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
48982477 |
cgagaataaaattaagtgtagttgataggagaatattatgttgaatgtatgataaaactagacgaaattggattaagaatgacaatattaaataaaaaaa |
48982576 |
T |
|
| Q |
101 |
ttgaggtaac-------gtagaaaagatgacggaagcaaacttatgtgatttggtcatgtggtgaaatgacttctattactaatgaatactctagatgtt |
193 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48982577 |
ttgaggtaacatctattgtagaaaagatgatggaagcaagcttatgtgatttggtcatgtggtgaaatgacttctattactaatgaatactctagatgtt |
48982676 |
T |
|
| Q |
194 |
aatgatttggataatgatgtaacaca |
219 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
48982677 |
aatgatttggataatgatgtaacaca |
48982702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University