View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1860_low_51 (Length: 236)
Name: NF1860_low_51
Description: NF1860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1860_low_51 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 13067380 - 13067164
Alignment:
| Q |
1 |
tttcttggaattagttggaccccctctcatagttgccaaaactctgctcatgatgtggataacgttcattgatcagttcagtggtaataataaagcttgt |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13067380 |
tttcatggaattagttggaccccctctcatagttgccaaaactctgctcatgatgtggataacgttcattgatcagttcagtggtaataataaagcttgt |
13067281 |
T |
|
| Q |
101 |
gtttgtgaaccaccgtcctttaattttggacagaggagataaaaacgtcggtagcataccaattattgtccaatttggcataattctatcgctatccgtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13067280 |
gtttgtgaaccaccgtcctttaattttggacagaggagataaaaacgtcgctagcataccaattattgtccaatttggcataattctatcgctatccgtc |
13067181 |
T |
|
| Q |
201 |
tcaaatagtggacagat |
217 |
Q |
| |
|
|| |||||||||||||| |
|
|
| T |
13067180 |
tccaatagtggacagat |
13067164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University