View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1860_low_58 (Length: 211)
Name: NF1860_low_58
Description: NF1860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1860_low_58 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 3e-59; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 18 - 137
Target Start/End: Original strand, 40761599 - 40761718
Alignment:
| Q |
18 |
atgtttaaggcaaatcatccatatattctgaaagatatcatacaaagatgcaaccttgttgagttactactccttcaactactacacctcttgtgtaaca |
117 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40761599 |
atgtttaaggcaaatcaaccatatattctgaaagatatcatacaaagatgcaaccttgttgagttactactccttcaactactacacctcttgtgtaaca |
40761698 |
T |
 |
| Q |
118 |
gcaggatcttgttcttcctt |
137 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
40761699 |
gcaggatcttgttcttcctt |
40761718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 170 - 198
Target Start/End: Original strand, 40761739 - 40761767
Alignment:
| Q |
170 |
atgctggtgctgattcagttttctctgct |
198 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40761739 |
atgctggtgctgattcagttttctctgct |
40761767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University