View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1860_low_61 (Length: 203)

Name: NF1860_low_61
Description: NF1860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1860_low_61
NF1860_low_61
[»] chr2 (1 HSPs)
chr2 (60-145)||(18974345-18974428)


Alignment Details
Target: chr2 (Bit Score: 59; Significance: 3e-25; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 60 - 145
Target Start/End: Complemental strand, 18974428 - 18974345
Alignment:
60 gaatgtgattgtgataaaaaagtgtaaaaactcatgaatatttttttaatgatttttcatatgtaaaacattgttaagtatttgca 145  Q
    ||||| || |||||||||||  | ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
18974428 gaatgggaatgtgataaaaa--tttaaaaactcatgaatatttttttaatgattttttatatgtaaaacattgttaagtatttgca 18974345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University