View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18610_high_1 (Length: 312)
Name: NF18610_high_1
Description: NF18610
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18610_high_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 3e-82; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 108 - 303
Target Start/End: Complemental strand, 38599456 - 38599256
Alignment:
| Q |
108 |
actagaaacaataaaatatttctagtggnnnnnnn--cctttccggtttgttgctaatttgtgaactatgcattgcttatat---atcctttaaacaata |
202 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38599456 |
actagaaacaataaaatatttctagtggaaaaaaaaacctttccggtttgttgctaatttgtgaactatgcattgcttatattatatcctttaaacaata |
38599357 |
T |
|
| Q |
203 |
acttttgcataaaaataaaactatcaagagaaaacagtgttcacgtagctataaattttctcaaacaacctatgtctttatatcattgatcctagaataa |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38599356 |
acttttgcataaaaataaaactatcaagagaaaacagtgttcacgtagctataaattttctcaaacaacctatgtctttatatcattgatcctagaataa |
38599257 |
T |
|
| Q |
303 |
t |
303 |
Q |
| |
|
| |
|
|
| T |
38599256 |
t |
38599256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 19 - 135
Target Start/End: Complemental strand, 38599613 - 38599497
Alignment:
| Q |
19 |
aacttgatatctataatgcactgtagaacaactatgagactagcagctttttgatctctggccttgtcatgagttcatattcgaagggaactagaaacaa |
118 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38599613 |
aacttgatatctataatgcaccgtagaacaactatgagactagcaactttttgatgtctggccttgtcatgagttcatattcgaagggaactagaaacaa |
38599514 |
T |
|
| Q |
119 |
taaaatatttctagtgg |
135 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
38599513 |
taaaatatttctagtgg |
38599497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 265 - 301
Target Start/End: Original strand, 2829701 - 2829737
Alignment:
| Q |
265 |
aaacaacctatgtctttatatcattgatcctagaata |
301 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
2829701 |
aaacaacctatgtcttcatatcattgatgctagaata |
2829737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 97; Significance: 1e-47; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 159 - 302
Target Start/End: Original strand, 56425068 - 56425211
Alignment:
| Q |
159 |
ctaatttgtgaactatgcattgcttatatatcctttaaacaataacttttgcataaaaataaaactatcaagag-aaaacagtgttcacgtagctataaa |
257 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||||||| | ||||||||||| | ||||| ||||| |
|
|
| T |
56425068 |
ctaatttgtgaactctgcattgct-atatatcctttaaacaatcacttttgcataaaaataaaactatcaaaaataaaacagtgtttaggtagcgataaa |
56425166 |
T |
|
| Q |
258 |
ttttctcaaacaacctatgtctttatatcattgatcctagaataa |
302 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
56425167 |
ttttctcaaacaaactatgtctttatatcattgatcctagaataa |
56425211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 26 - 100
Target Start/End: Original strand, 39492774 - 39492848
Alignment:
| Q |
26 |
tatctataatgcactgtagaacaactatgagactagcagctttttgatctctggccttgtcatgagttcatattc |
100 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||| ||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
39492774 |
tatctataatgcactgtagaacagctttgagactagcaacttcttgatctctggccttgtcctgagttcatattc |
39492848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 26 - 100
Target Start/End: Complemental strand, 39131630 - 39131556
Alignment:
| Q |
26 |
tatctataatgcactgtagaacaactatgagactagcagctttttgatctctggccttgtcatgagttcatattc |
100 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||| |||| ||| |||||||||||||||||| |||||||| |||| |
|
|
| T |
39131630 |
tatctataatgcattgtagaacagctatgagacaagcaacttcttgatctctggccttgtcctgagttcacattc |
39131556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 26 - 100
Target Start/End: Complemental strand, 39469435 - 39469361
Alignment:
| Q |
26 |
tatctataatgcactgtagaacaactatgagactagcagctttttgatctctggccttgtcatgagttcatattc |
100 |
Q |
| |
|
|||||| |||||| ||||||||| | |||||||||||| ||| ||||||| | ||||| || |||||||| |||| |
|
|
| T |
39469435 |
tatctacaatgcattgtagaacagcaatgagactagcaacttcttgatctttagccttttcctgagttcacattc |
39469361 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University