View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18611_high_11 (Length: 269)
Name: NF18611_high_11
Description: NF18611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18611_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 39295924 - 39295669
Alignment:
| Q |
1 |
ccttgatccagcagaataatcgacaacctcaaattttttgttggtatgtcagactttggtagtacctcaactctctcttggttattttccatgtcctgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
39295924 |
ccttgatccagcagaataatcgacaacctcgaattttttgttggtatgtcagactttggtagtacctcaactttctcttggttattttccatgtcctgaa |
39295825 |
T |
|
| Q |
101 |
tttcagctagaaattcatactcatcatcgtcagcatcaatgttgatgtcacagaagtgactactagctcgactttgagtcctagttgaactaatagcttg |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39295824 |
cttgagctagaaattcatactcatcatcgtcagcatcaatgttgatgtcacagaagtgactactagctcgactttgagtcctagttgaactaatagcttg |
39295725 |
T |
|
| Q |
201 |
agaattgtttcttgtccatggaggaatccaaagccatgttcctgctttctctgtct |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39295724 |
agaattgtttcttgtccatggaggaatccaaagccatgttcctgctttctctgtct |
39295669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 55 - 173
Target Start/End: Complemental strand, 39288987 - 39288869
Alignment:
| Q |
55 |
tttggtagtacctcaactctctcttggttattttccatgtcctgaatttcagctagaaattcatactcatcatcgtcagcatcaatgttgatgtcacaga |
154 |
Q |
| |
|
||||||||||||| |||| | |||||||||||||| ||||| |||| |||||||||||||||||||||| |||| ||||||||||||||||||||||| | |
|
|
| T |
39288987 |
tttggtagtaccttaactttttcttggttattttctatgtcttgaacttcagctagaaattcatactcaacatcatcagcatcaatgttgatgtcacaaa |
39288888 |
T |
|
| Q |
155 |
agtgactactagctcgact |
173 |
Q |
| |
|
| |||||||| |||||||| |
|
|
| T |
39288887 |
aatgactacttgctcgact |
39288869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University