View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18611_high_12 (Length: 257)
Name: NF18611_high_12
Description: NF18611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18611_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 21 - 237
Target Start/End: Complemental strand, 17542372 - 17542158
Alignment:
| Q |
21 |
ttacaagttagcaagacccttagcatgtgaaagagtctgatagtgttgaggaagcatcaaaagccactgaagttccatagattgtaaaatctggacttca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17542372 |
ttacaagttagcaagacccttagcatgtgaaagagtctgatagtgttgaggaagcatcagaagctactgaagttccatagattgtaaaatctggacttca |
17542273 |
T |
 |
| Q |
121 |
aggttcatggttagccaaattctttgagaagacagagcttgttgtgctaaaaagtcaagaacatgatgttattatatctttcaagacaagttacaagttg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
17542272 |
aggttcatggttagccaaattctttgagaagacagagcctgttgtgctaaaaagtcaagaacatgaggttat--tatctttcaagacaagttacaagttg |
17542175 |
T |
 |
| Q |
221 |
atatggaagatcagaag |
237 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
17542174 |
atatggaagatccgaag |
17542158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 46960646 - 46960618
Alignment:
| Q |
1 |
aatgcatatgcctatgtttgttacaagtt |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46960646 |
aatgcatatgcctatgtttgttacaagtt |
46960618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University