View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18611_high_13 (Length: 243)
Name: NF18611_high_13
Description: NF18611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18611_high_13 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 20 - 243
Target Start/End: Original strand, 12818406 - 12818635
Alignment:
| Q |
20 |
cggccccggccaaatatctgacaaatcaccaatatctacctgcggaacatcaccggtggacattacggaaaaaatctcagcgttggttaaccccgcatcc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12818406 |
cggccccggccaaatatctgacaaatcaccaatatctacctgcggaacatcaccggtggacattacggaaaaaatatcagcgttggttaaccccgcatcc |
12818505 |
T |
 |
| Q |
120 |
tcaggctcagaaactcccacaaca------tcaacgtcaatgtcatcctcaagatcagccaaagaaatacccatttgagcaggatctagggtttcagaaa |
213 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12818506 |
tcaggctcagaaactcccacaacatcaacgtcaacgtcaatgtcatcctcaagatcagccaaagaaatacccatttgagcaggatctagggtttcagaaa |
12818605 |
T |
 |
| Q |
214 |
ttgaactcatcattgaagatgaattcattt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12818606 |
ttgaactcatcattgaagatgaattcattt |
12818635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University