View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18611_low_2 (Length: 553)
Name: NF18611_low_2
Description: NF18611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18611_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 314; Significance: 1e-177; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 1 - 367
Target Start/End: Complemental strand, 25296350 - 25295980
Alignment:
| Q |
1 |
catcagcaaagaaacttctaactaatcacaacagtggttctcttctcgtagcatgcttcatggattgtagaatttccctccgcaaaagcacctccaggct |
100 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25296350 |
catcaacaaagaaacttctaactgatcacaacagtggttctcttctcgtagcatgcttcatggattgtagaatttccctccgcaaaagcacctccaggct |
25296251 |
T |
 |
| Q |
101 |
tgagggaaattcccggctgaaattccaacattccccaccattgctatgcatgggatgcatttgccacatttggcaatgcaccgtggtggggaagatcatg |
200 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25296250 |
tgagggaaatacccgactgaaattccaacattccccaccattgctatgcatgggatgcatttgccacatttggcaatgcaccgtggtggggaagatcatg |
25296151 |
T |
 |
| Q |
201 |
ggcctgagttggccacaatgcagaagaagatgatgatga----tgaatattgtttagttcctcatagttcagaagtgagttcgcagggagaagtgacact |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||| |||||||||||| ||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
25296150 |
ggcctgagttggccacaatgcagaagaagaagaagatgatcagtgaatattgtttggttcctcatagctcagaagtgaggtcgcagggagaagtgacact |
25296051 |
T |
 |
| Q |
297 |
agattaatagtatatgtacattctctactcttctacagcgctcttggtcaaattgtgaactgttatattac |
367 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25296050 |
agattaatagtatatgtacattctctactcttctacagcgctcttggtcaaattgtgaactgtcatattac |
25295980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 471 - 535
Target Start/End: Complemental strand, 25294016 - 25293949
Alignment:
| Q |
471 |
tgtttcagtataatgatctaactgaaaccgtgttcgta---attcaacttttacgaaggaaccctcat |
535 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
25294016 |
tgtttcagtataatgatccaactgaaaccgtgttcgtaaggattcaacttttatgaaggaaccctcat |
25293949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University