View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18611_low_9 (Length: 295)

Name: NF18611_low_9
Description: NF18611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18611_low_9
NF18611_low_9
[»] chr5 (2 HSPs)
chr5 (1-99)||(12818712-12818810)
chr5 (252-283)||(12818963-12818994)


Alignment Details
Target: chr5 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 12818712 - 12818810
Alignment:
1 ttcggagaagaaataattgagagaaagagaagtttaggatttccaagaagtgaagtgaaattcttggttggttttaataaattagggttttgaagtgat 99  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
12818712 ttcgaagaagaaataattgagagaaagagaagtttaggatttccaagaagtgaagtgaaattcttggttggttataataaattagggttttgaagtgat 12818810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 252 - 283
Target Start/End: Original strand, 12818963 - 12818994
Alignment:
252 atagattttgatagatactgtaaaccatgtct 283  Q
    ||||||||||||||||||||||||||||||||    
12818963 atagattttgatagatactgtaaaccatgtct 12818994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University