View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18611_low_9 (Length: 295)
Name: NF18611_low_9
Description: NF18611
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18611_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 12818712 - 12818810
Alignment:
| Q |
1 |
ttcggagaagaaataattgagagaaagagaagtttaggatttccaagaagtgaagtgaaattcttggttggttttaataaattagggttttgaagtgat |
99 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
12818712 |
ttcgaagaagaaataattgagagaaagagaagtttaggatttccaagaagtgaagtgaaattcttggttggttataataaattagggttttgaagtgat |
12818810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 252 - 283
Target Start/End: Original strand, 12818963 - 12818994
Alignment:
| Q |
252 |
atagattttgatagatactgtaaaccatgtct |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12818963 |
atagattttgatagatactgtaaaccatgtct |
12818994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University