View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18612_high_13 (Length: 277)
Name: NF18612_high_13
Description: NF18612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18612_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 16 - 257
Target Start/End: Original strand, 12117143 - 12117385
Alignment:
| Q |
16 |
aatataattcgaacattttattagtgtgttttgaattttatatgggaattaggaccttcaccaaatgcttatattaaattataagagaggaaattggcta |
115 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
12117143 |
aatataatccgaacattttattagtgtgttttgaattttatatgggaattaggaccttcaccaaatgcttat--taaattatcagagaggaaattggcta |
12117240 |
T |
 |
| Q |
116 |
cttataaacttttcaggttttgagatgctt---atatcaaagaaagtagtagtagtaacttgcatggggaatactttcatctgctgcattcattcctttt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12117241 |
cttataaacttttcaggttttgagatgcatcatatatcaaagaaagtagtagtagtaacttgcatgggtaatactttcatctgctgcattcattcctttt |
12117340 |
T |
 |
| Q |
213 |
ctgcataaagttccttttaagggagtaaaaaattctcacaggctt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12117341 |
ctgcataaagttccttttaagggagtaaaaaattcctacaggctt |
12117385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University