View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18612_low_21 (Length: 248)
Name: NF18612_low_21
Description: NF18612
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18612_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 110 - 231
Target Start/End: Original strand, 12117597 - 12117716
Alignment:
| Q |
110 |
aaatgtttggatgaacttctttaagcttgtaagaattataaaattcttttctatatttaattgaannnnnnncatattaactacatgttaatataaattg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| |||| ||||||||||| |
|
|
| T |
12117597 |
aaatgtttggatgaacttctttaagcttgtaagaattataaaattcttttctatatttaattgaattattttc--attaactagatgtaaatataaattg |
12117694 |
T |
 |
| Q |
210 |
ggctaaaatctactcctattta |
231 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
12117695 |
ggctaaaatctactcctattta |
12117716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University