View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18613_low_4 (Length: 295)
Name: NF18613_low_4
Description: NF18613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18613_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 94 - 288
Target Start/End: Original strand, 3154080 - 3154274
Alignment:
| Q |
94 |
agtcagatacaaaaaagtgcatgcactaaagtattatggtttaccatctggaacattttctttgcaaacgtattatcagggtcggctctctaccgattga |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3154080 |
agtcagatacaaaaaagtgcatgcactaaagtattatggtttaccatctggaacattttctttgcaaacgtattatcagggtcggctctctaccgattga |
3154179 |
T |
 |
| Q |
194 |
actactttcttgagcccaaagagtttcctagagtaccagctgaagcagtaccagctcaggtgagaataatgactagttctgctaaatgatgatgt |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3154180 |
actactttcttgagcccaaagagtttcctagagtactagctgaagctgtaccagctcaggtgagaataatgactagttctgctaaatgataatgt |
3154274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 94 - 209
Target Start/End: Original strand, 4007507 - 4007622
Alignment:
| Q |
94 |
agtcagatacaaaaaagtgcatgcactaaagtattatggtttaccatctggaacattttctttgcaaacgtattatcagggtcggctctctaccgattga |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||| |||||||||||||||||||| ||| |||||||||| ||||| || ||| ||| |
|
|
| T |
4007507 |
agtcagatacaaaaaagtgcatgcactaaagtgttactgtttaccatatggaacattttctttgcaaatgtactatcagggtctgctctttatcgagtga |
4007606 |
T |
 |
| Q |
194 |
actactttcttgagcc |
209 |
Q |
| |
|
|| |||||||||||| |
|
|
| T |
4007607 |
acatctttcttgagcc |
4007622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University