View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18613_low_6 (Length: 279)
Name: NF18613_low_6
Description: NF18613
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18613_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 13 - 264
Target Start/End: Original strand, 29602250 - 29602504
Alignment:
| Q |
13 |
aatatggcttgattgactnnnnnnnngttgcttgcttggtacataatctttaacacaaaattagacatcaatattatatatttgtatagt---taccaac |
109 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
29602250 |
aatatggcttgattgactaaaaaaaagttgcttgcttggtacataatctttaacacaaaattagacatcaatattatatatttgtatagtaattaccaac |
29602349 |
T |
 |
| Q |
110 |
ttttatgttactttttctctaaccttgggcannnnnnnctcgctttaggttcaacattactcattcatatagtgttgattttcgtaaatgacacagttga |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29602350 |
ttttatgttactttttctctaaccttgggcatttttttctctctttaggttcaacatgactcattcatatagtgttgattttcgtaaatgacacagttga |
29602449 |
T |
 |
| Q |
210 |
tgcaacaatggttgaacacttaacnnnnnnnnntcaacctcaatcatatgtttag |
264 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
29602450 |
tgcaacaatggttgatcacttaacaaaaaaacatcaacctcaatcatatgtttag |
29602504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 72; Significance: 8e-33; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 39 - 138
Target Start/End: Complemental strand, 32273269 - 32273170
Alignment:
| Q |
39 |
gttgcttgcttggtacataatctttaacacaaaattagacatcaatattatatatttgtatagttaccaacttttatgttactttttctctaaccttggg |
138 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||| ||||||||||||| |||||||| ||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
32273269 |
gttgtttgcttggtacatattctttaacacaaaattcgacatcaatattacatatttgtttagtttccaacttttatgttactttttatctaaccttggg |
32273170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University