View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18614_high_8 (Length: 213)
Name: NF18614_high_8
Description: NF18614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18614_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 16 - 196
Target Start/End: Original strand, 49234043 - 49234223
Alignment:
| Q |
16 |
aatatcagcggctttcatattcaattcaaaaatcctgtttccaagtttcatcactatttaagacatatatacattttgctctattttgtgtacaccctat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
49234043 |
aatatcagcggctttcatattcaattcaaaaatcctgtttccaagtttcatcactatttaagacatatatacattttgctctattttgtgtacaccccat |
49234142 |
T |
 |
| Q |
116 |
ttcagcataattaaggtttgtgttattgttacaatggagggtaggggtaaggccatcgttgatggagtagaagggaattat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49234143 |
ttcagcataattaaggtttgtgttattgttacaatggagggtaggggtaaggccatcattgatggagtagaagggaattat |
49234223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University