View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18615_high_5 (Length: 432)
Name: NF18615_high_5
Description: NF18615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18615_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 48995807 - 48996047
Alignment:
| Q |
1 |
tcatctaatgtcatgaattaactttaccggttacttcctgaaccacaaccttccttataatcacaacaaattggtttcctcagttgtctgatcagaacca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48995807 |
tcatctaatgtcatgaattaactttaccggttacttcctgaactacaaccttccttataatcacaacaaattggtttcctcagttgtctgatcagaacca |
48995906 |
T |
 |
| Q |
101 |
ttgaggaatgatctggcatgacccttccacaaagtacaattaagcaagtttcccctaaaatgaagatgaccagagtttatcaagctgggtgtttgaattc |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48995907 |
ttgaggaatgatctggcatgaccctcccacaaagtacaattaagcaagtttcccctaaaatgaagatgaccagagtttatcaagctgggtggttgaattc |
48996006 |
T |
 |
| Q |
201 |
aaggtggttggcttggctatggaactttggtgtgaagtagg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48996007 |
aaggtggttggcttggctatggaactttggtgtgaagtagg |
48996047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 140; E-Value: 3e-73
Query Start/End: Original strand, 269 - 416
Target Start/End: Original strand, 48996075 - 48996222
Alignment:
| Q |
269 |
tatacatccttaattccttagtctcacaattgctgggaaattaatgaatgtgagttttaacacgcttgcagcagtaatttggtacaccacttcaaagcat |
368 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48996075 |
tatacatccttaattccttagtctcgcatttgctgggaaattaatgaatgtgagttttaacacgcttgcagcagtaatttggtacaccacttcaaagcat |
48996174 |
T |
 |
| Q |
369 |
gcaacaactcatagttaaaataaaacggtcaattgcagggtgcgtgtg |
416 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48996175 |
gcaacaactcatagttaaaataaaacggtcaattgcagggtgcgtgtg |
48996222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University