View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18615_low_11 (Length: 260)
Name: NF18615_low_11
Description: NF18615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18615_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 17 - 254
Target Start/End: Complemental strand, 45986660 - 45986423
Alignment:
| Q |
17 |
atgaattccacacaaaactttaactaccggacttactttgtatatttctacactttcattagctttgcattttataggaaacaaacattttgttacctac |
116 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45986660 |
atgaattccacacgaaactttaactaccggacttactttgtatatttctacactttcattagctttgcattttataggaaacaaacattttgttacctac |
45986561 |
T |
|
| Q |
117 |
tgtcttcttattttatgaaaagtcagctattactactttaaattcttgttcttttgaaaagacatcatcccctcgatcattgccatttttcatttgagat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45986560 |
tgtcttcttattttatgaaaagtcagctattactactttcaattcttgttcttttgaaaagccatcatcccctcgatcattgccatttttcatttgagat |
45986461 |
T |
|
| Q |
217 |
tgctcatagcttctgtgacatttcatggaacaaactgt |
254 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
45986460 |
tgctcatagcttctgtgacgtttcatggaacaaactgt |
45986423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University