View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18615_low_12 (Length: 205)
Name: NF18615_low_12
Description: NF18615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18615_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 7e-82; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 38835474 - 38835631
Alignment:
| Q |
18 |
tcatcaatgacttcattatcactatctgatttcaaacctatggtacttgacttcttttttgcaccgccccttttgttaatctgtttcttcccagcaggca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38835474 |
tcatcaatgacttcattatcactatctgattccaaacctatggtacttgacttcttttttgcaccgccccttttgttaatctgtttcttcccagcaggca |
38835573 |
T |
|
| Q |
118 |
cgggttcttcactttccatggctgtggaagaaaacccaacttcagtactagcatgtat |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38835574 |
cgggttcttcactttccatggctgtggaagaaaacccaacttcagtactagcatgtat |
38835631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 27 - 116
Target Start/End: Original strand, 9870035 - 9870124
Alignment:
| Q |
27 |
acttcattatcactatctgatttcaaacctatggtacttgacttcttttttgcaccgccccttttgttaatctgtttcttcccagcaggc |
116 |
Q |
| |
|
||||| |||||||| ||||||| ||| |||||||| ||||||||||||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9870035 |
acttcgttatcactgtctgattccaacactatggtatttgacttctttttagcaccaccccttttgttaatctgtttcttcccagcaggc |
9870124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University