View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18616_low_8 (Length: 369)
Name: NF18616_low_8
Description: NF18616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18616_low_8 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 3 - 369
Target Start/End: Complemental strand, 17108152 - 17107781
Alignment:
| Q |
3 |
atcattattgtaagccataatgggattattgacatatttgcatagaacctttatgggaatctttttacgagctttagcattttttatcctccttatcatc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17108152 |
atcattattgtaagccataatgggattattgacatatttgcatagaacctttatgggaatctttttacgagctttagcattttttatcctccttatcatc |
17108053 |
T |
|
| Q |
103 |
tctataaatcttggctttcttgcactcattgatcgaatgccgaacatttttgctaacattaccaaactatggagtttttcagaa-----tcaatgtccac |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17108052 |
tctataaatcttggctttcttgcactcattgatcgaatgccgaacatttttgctaacattaccaaactatggagtttttcagaatcaaatcaatgtccac |
17107953 |
T |
|
| Q |
198 |
atagaatgagtattcagatctttcaactaacattttatcatgtaactgtccagaaagatcaatatctactagaattctagcatagtgatcaaagcttcga |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
17107952 |
atagaatgagtattcagatctttcaactaacattttatcatgtaactttccagaaagatcaacatctaccagaattctagcatggtgatcaaagcttcga |
17107853 |
T |
|
| Q |
298 |
taaaaattagacttacttgtattgttgtcgatgcatataggtgtccacaatactcctgatcaattccagata |
369 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17107852 |
taaaaattagacttgctagtattgttgtcgatgcatataggtgtccacaatactcctgatcaattccagata |
17107781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University