View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18617_high_9 (Length: 403)
Name: NF18617_high_9
Description: NF18617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18617_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 3e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 16 - 168
Target Start/End: Complemental strand, 27510428 - 27510276
Alignment:
| Q |
16 |
atcattaatggcatcaaaactatatcatggtcatggttcgtcggctttaagaactaaaattgtgatataatgtttgctaattggtgtactaaccttataa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
27510428 |
atcattaatggcatcaaaactatatcatggtcatggttcgtcggctttaagaacaaacattgtggtataatgtttgctaattggtgtactcaccttatag |
27510329 |
T |
 |
| Q |
116 |
cttgcatgcttagagtttgagtcttgtttttaaatggaagtaaatcgggttgt |
168 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27510328 |
cttggatgcttagagtttgagtcttgtttgtaaatggaagtaaatcgggttgt |
27510276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University