View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18617_low_17 (Length: 275)
Name: NF18617_low_17
Description: NF18617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18617_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 16 - 258
Target Start/End: Complemental strand, 49728059 - 49727817
Alignment:
| Q |
16 |
atcagagctaccagtactccagcagaagatgcaactgcataatatatcaggaaattagtagtccagtgcagaagaagtgttattaattgttataccacag |
115 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49728059 |
atcagagctaccagtactccaacagaagatgcaactgcataatatatcaggaaattaatggtccagtgcagaagaagtgttattaattgttataccacag |
49727960 |
T |
 |
| Q |
116 |
tatatttagcatttctgaaaagtggacctttcacacctatcttcataacaccacttatttctacgaagcaaagttataaaattcaattggtgattaacta |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| | |
|
|
| T |
49727959 |
tatatttagcatttctgaaaagtggacctttcacacctatcttcataacaccacttatttctaggaagcaaagttataaaattcaattggcgattaacaa |
49727860 |
T |
 |
| Q |
216 |
gtagaatagacattgagatattgaactactagttaattaaatc |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49727859 |
gtagaatagacattgagatattgaactactagttaattaaatc |
49727817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University