View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18617_low_20 (Length: 239)
Name: NF18617_low_20
Description: NF18617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18617_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 9e-51; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 37632953 - 37632817
Alignment:
| Q |
1 |
ttttctggttacatccattagaaaattattcaaaatgttaacaattggctaatataaagttttacaagtagaaccagaagttcttgattttcattgttgc |
100 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
37632953 |
ttttctgattacatccattagaaa-ttattcaaaatgttaacaattggctaatataaatttttacaagtagaatcagaagttcttgattttcgttgttgc |
37632855 |
T |
 |
| Q |
101 |
aacctctaagacaatagacggatcggtgtcaatttgaa |
138 |
Q |
| |
|
||| ||||||||||||||| ||||| |||||||||||| |
|
|
| T |
37632854 |
aacatctaagacaatagacagatcgctgtcaatttgaa |
37632817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University